Skip Navigation

Plasmid-Mediated Quinolone Resistance in Non-Typhi Serotypes of Salmonella enterica

  1. Kathryn Gay1,2,a,
  2. Ari Robicsek3,a,
  3. Jacob Strahilevitz4,
  4. Chi Hye Park4,
  5. George Jacoby5,
  6. Timothy J. Barrett2,
  7. Felicita Medalla1,2,
  8. Tom M. Chiller2, and
  9. David C. Hooper5
  1. 1Atlanta Research and Education Foundation, Atlanta, Georgia
  2. 2Centers for Disease Control and Prevention, Atlanta, Georgia
  3. 3Evanston Northwestern Healthcare, Evanston, Illinois
  4. 4Massachusetts General Hospital, Boston
  5. 5Lahey Clinic, Burlington, Massachusetts
  1. Reprints or correspondence: Dr. Kathryn Gay, Mail Stop G-29, Centers for Disease Control and Prevention, 1600 Clifton Rd., Atlanta, GA 30333 (kgay{at}cdc.gov).

  • ↵a K.G. and A.R. contributed equally to this article.

 
Next Section

Abstract

Background. Serious infections with Salmonella species are often treated with fluoroquinolones or extended-spectrum β-lactams. Increasingly recognized in Enterobacteriaceae, plasmid-mediated quinolone resistance is encoded by qnr genes. Here, we report the presence of qnr variants in human isolates of non-Typhi serotypes of Salmonella enterica (hereafter referred to as non-Typhi Salmonella) from the United States National Antimicrobial Resistance Monitoring System for Enteric Bacteria.

Methods. All non-Typhi Salmonella specimens from the United States National Antimicrobial Resistance Monitoring System for Enteric Bacteria collected from 1996 to 2003 with ciprofloxacin minimum inhibitory concentrations ⩾0.06 µg/mL (233 specimens) and a subset with minimum inhibitory concentrations ⩽0.03 µg/mL (102 specimens) were screened for all known qnr genes (A, B, and S) by polymerase chain reaction. For isolates with positive results, qnr and quinolone resistance—determining region sequences were determined. Plasmids containing qnr genes were characterized by conjugation or transformation.

Results. Conjugative plasmids harboring qnrB variants were detected in 7 Salmonella enterica serotype Berta isolates and 1 Salmonella enterica serotype Mbandaka isolate. The S. Mbandaka plasmid also had an extended-spectrum β-lactamase. Variants of qnrS on nonconjugative plasmids were detected in isolates of Salmonella enterica serotype Anatum and Salmonella enterica serotype Bovismorbificans.

Conclusions. Plasmid-mediated quinolone resistance appears to be widely distributed, though it is still uncommon in non-Typhi Salmonella isolates from the United States, including strains that are quinolone susceptible by the criteria of the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards). The presence of this gene in non-Typhi Salmonella that causes infection in humans suggests potential for spread through the food supply, which is a public health concern.

Until recently, quinolone resistance was believed to arise solely from chromosomal mutations in genes encoding target enzymes or affecting drug accumulation [1]. In 1998, a novel means of quinolone resistance was described in the first confirmed report of horizontally transmissible quinolone resistance [2]. The locus responsible for this plasmid-mediated quinolone resistance, designated qnrA, was found on the conjugative plasmid of a clinical Klebsiella pneumoniae isolate. Encoding a pentapeptide repeat protein protecting type II topoisomerases, qnrA was later found to reside within class 1 integrons harboring other antimicrobial resistance cassettes [3, 4]. The qnrA gene confers nalidixic acid and low-level fluoroquinolone (e.g., ciprofloxacin) resistance, and its presence has been shown to facilitate selection of chromosomal mutations that confer higher levels of resistance [2]. Subsequently, qnrA has been described in clinical isolates of K. pneumoniae, Escherichia coli, Providencia stuartii, and Citrobacter freundii [5, 6]. A recent study found that 17% of ceftazidime-resistant Enterobacter species in the United States harbored qnrA [7].

Within the last 2 years, other plasmid-mediated members of the pentapeptide repeat family, QnrB, and QnrS, have been identified in Enterobacteriaceae species [5]. qnrB was found in clinical isolates of K. pneumoniae, Citrobacter koseri, Enterobacter cloacae, and E. coli from India and the United States [8], and qnrS was discovered in a strain of Shigella flexneri 2b from an outbreak of food poisoning in Japan [9]. qnrB and qnrS are also associated with β-lactamase genes on conjugative plasmids.

Most Enterobacteriaceae species in which qnr genes have been detected are regular constituents of human flora. Thus, the maintenance and spread of quinolone resistance in these organisms may be promoted by human exposure to quinolones. In contrast, non-Typhi serotypes of Salmonella enterica (hereafter referred to as non-Typhi Salmonella) are largely carried in the intestinal tract of food animals and are transmitted to humans through the food chain [10]. Therefore, quinolone use in agriculture may drive the dissemination of qnr-mediated resistance in these pathogens. Until recently, it was not known whether animal-associated infectious agents could harbor qnr genes. The report of a qnrA variant in an isolate of Salmonella enterica serotype Enteritidis in Hong Kong, however, indicates that this is possible [11].

An estimated 1.4 million people in the United States are infected with non-Typhi Salmonella annually, resulting in 15,000 hospitalizations and >400 deaths [12]. Fluoroquinolones are an important antimicrobial class in the treatment of severe Salmonella infection [13]. The prevalence of quinolone-resistant Salmonella has recently increased in the United States (J. Stevenson, F. Angulo, K.G., T.B., F.M., T.C.; unpublished data). The role of plasmid mediation in this form of quinolone resistance is not known. Therefore, we used strains collected by the National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS-EB) to determine the incidence of plasmid-mediated quinolone resistance among non-Typhi Salmonella serotypes in the United States.

Previous SectionNext Section

Methods

Bacteria and antimicrobial susceptibility testing. Starting in 1996, public health laboratories from 13 states submitted every 10th Salmonella specimen isolated from humans to the Centers for Disease Control and Prevention for susceptibility testing. The original sites were California (Alameda, Los Angeles, and San Francisco counties), Colorado, Connecticut, Florida, Georgia, Kansas, Massachusetts, Minnesota, New Jersey, New York (Bronx, Brooklyn, New York, Queens, and Richmond counties), Oregon, Washington, and West Virginia. Maryland began submitting isolates in 1997. In 1999, Tennessee was added, and statewide submissions from New York were accepted. Twenty-six states participated in 2002, with the addition of the following states: Arizona, Hawaii, Louisiana, Maine, Michigan, Montana, Nebraska, New Mexico, South Dakota, Texas, and Wisconsin. Also in 2002, surveillance in California extended statewide. In 2003, the study expanded nationwide, and each site submitted every 20th Salmonella isolate from humans. Further information on NARMS-EB surveillance can be found on the NARMS-EB Web site [14].

Antimicrobial susceptibility testing was performed at the Centers for Disease Control and Prevention (Atlanta, GA). MICs were determined by microbroth dilution using Sensititre (Trek Diagnostic Systems) for ampicillin, cefoxitin, ceftiofur, ceftriaxone, cephalothin, chloramphenicol, ciprofloxacin, gentamicin, kanamycin, nalidixic acid, streptomycin, sulfamethoxazole, tetracycline, and trimethoprim-sulfamethoxazole. With the exception of ceftiofur and streptomycin, susceptibility interpretations for available antimicrobials were defined according to Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards) breakpoints; ciprofloxacin and nalidixic acid resistances were defined as MICs ⩾4 µg/mL and ⩾32 µg/mL, respectively [15]. Ceftiofur and streptomycin resistance breakpoints were defined as MICs ⩾8 µg/mL and ⩾64 µg/mL, respectively. All available isolates with ciprofloxacin MICs ⩾0.06 µg/mL were selected for screening for qnr genes by PCR. A control group was selected as follows. For each qnr-positive isolate, 2 isolates were selected with ciprofloxacin MICs ⩽0.03 matched for serotype and year and location of acquisition (20 isolates). An additional 82 isolates with ciprofloxacin MICs ⩽0.03 were selected to represent the 5 most common Salmonella serotypes isolated from 1996 to 2003.

PCR screening. Screening was carried out by multiplex PCR amplification of qnrA, qnrB, and qnrS. Colonies were suspended in 50 µL of water in a microcentrifuge tube and boiled to prepare DNA templates for PCR. The primers used to amplify qnrA to give a 516—base pair (bp) product were 5′- ATTTCTCACGCCAGGATTTG and 5′-GATCGGCAAAGGTTAGGTCA. The primers used to amplify qnrA to give a 469-bp product were 5′- GATCGTGAAAGCCAGAAAGG and 5′-ACGATGCCTGGTAGTTGTCC. The primers used to amplify qnrS to give a 417-bp product were 5′- ACGACATTCGTCAACTGCAA and 5′- TAAATTGGCACCCTGTAGGC. All 6 primers were added to template and PCR Supermix High Fidelity (Invitrogen). PCR conditions were 94°C for 45 s, 53°C for 45 s, and 72°C for 60 s, cycled 32 times. Clinical isolates that had previous confirmation of the qnr gene by DNA sequencing were used as positive controls for qnrA, qnrB, and qnrS. Reaction mixes without a DNA template served as negative controls. All positive results were confirmed by direct sequencing of the PCR products.

Transfer of quinolone resistance and plasmid characterization. Conjugation experiments were carried out in Luria-Bertani broth with azide-resistant E. coli J53 as the recipient. Transconjugants were selected on trypticase soy agar plates containing ampicillin (100 µg/mL), gentamicin (10 µg/mL), tetracycline (20 µg/mL), or streptomycin (64 µg/mL)—but not a quinolone—to avoid the unintentional introduction of spontaneous quinolone-resistance mutations. Sodium azide (100 µg/mL) was used for counterselection. Transconjugants displaying reduced susceptibility to ciprofloxacin were tested against an antibiotic panel (nalidixic acid, ciprofloxacin, ampicillin, cefotaxime, chloramphenicol, gentamicin, sulfamethoxazole, and tetracycline) by agar dilution, in accordance with Clinical and Laboratory Standards Institute guidelines.

The qnrS-bearing plasmids could not be transferred by conjugation. For these, transformation was performed. Plasmid DNA was extracted from parent Salmonella strains using the Wizard Plus SV Miniprep (Promega) and introduced into electrocompetent E. coli DH10B (Invitrogen) by electroporation. Colonies were selected on ciprofloxacin 0.04 µg/mL. Plasmid DNA was extracted in the same way from these colonies, and the presence of qnrS was confirmed with Southern blot hybridization using a horseradish peroxidase—labeled qnrS PCR product obtained with the qnrS primers listed above.

Transformants selected in this manner on ciprofloxacin agar could have accumulated chromosomal ciprofloxacin-resistance mutations, invalidating MIC test results. Thus, to isolate transformants suitable for quinolone MIC testing (i.e., without the use of ciprofloxacin agar for selection), a Tn7-based transposon carrying a chloramphenicol-resistance gene was inserted into purified plasmids using the GPS-1 Genome Priming System (New England BioLabs). The resulting derivatives were introduced via electroporation into E. coli J53 and selected on chloramphenicol (20 µg/mL). Colonies were then individually tested for quinolone resistance. MICs for E. coli displaying reduced susceptibility to ciprofloxacin were tested as described above. For both qnrS-bearing plasmids, ∼4 kilobases (kb) of DNA flanking the qnr gene was sequenced using a series of outward-facing primers. The qnrS-bearing plasmids were extracted for size estimation using the Qiagen Midi Kit (Qiagen), according to the manufacturer's instructions, and run on a 0.8% agarose gel accompanied by a supercoiled DNA ladder (Invitrogen). pMG305 was extracted similarly, and run on 0.4% Megabase Agarose (Bio-Rad Laboratories) alongside a BAC-Tracker supercoiled DNA ladder (Epicentre) and comparator large plasmids. The sequences for qnrB5, qnrS1, and qnrS2 were submitted to GenBank (GenBank accession numbers DQ303919, DQ485529, and DQ485530, respectively). The β-lactamase gene in plasmid pMG307 was characterized and sequenced as previously described [6].

Quinolone resistance—determining region (QRDR) sequencing. The QRDR of qnr-positive strains was sequenced as follows. Crude DNA was prepared by suspending 4 or 5 colonies in 100 µL of water. A 255-bp region covering the QRDR of gyrA (Met52 to Leu137) was amplified with primers gyrA1 (5′- CATGAACGTATTGGGCAATG) and gyrA2 (5′- AGATCGGCCATCAGTTCGTG). The QRDRs of gyrB, parC, and parE were amplified using previously described primers [16]. PCR reactions contained 1 µL of the crude DNA suspension, 0.4 µM of each primer, and AmpliTaq Gold PCR Master Mix (Applied Biosystems) in a final volume of 50 µL. Primers were synthesized at the Biotechnology Core Facility–Scientific Resources Program, National Center for Infectious Diseases at the Centers for Disease Control and Prevention (Atlanta, GA). PCR was carried out in a thermal cycler (MJ Research) programmed with an initial 5-min denaturing step at 95°C, followed by 30 s at 95°C, 1 min at 55°C, and 30 s at 72°C for 35 cycles. Amplicons were sequenced with the primers listed above using ABI Big-Dye 3.1 dye chemistry and ABI 3730XL automated DNA sequencers (PE Biosystems). Analysis was performed using BioEdit software, version 7.05 [17]. The QRDR DNA sequences of gyrA, gyrB, parC, and parE for each of the qnr-positive isolates were compared with the QRDR DNA sequences of Salmonella enterica serotype Typhimurium LT2 (GenBank accession numbers AE008801, AE008878, AE008846, and AE008846, respectively).

Previous SectionNext Section

Results

Prevalence of fluoroquinolone resistance. From January 1996 through December 2003, NARMS-EB received 12,253 non-Typhi Salmonella isolates (table 1). Fourteen isolates (0.1%) were ciprofloxacin resistant (MIC, ⩾4 µg/mL). of the 14 isolates, 9 were Salmonella enterica serotype Senftenberg, 3 were Salmonella enterica serotype Schwarzengrund, 1 was Salmonella enterica serotype Indiana, and 1 was S. Typhimurium. Low-level ciprofloxacin resistance (MIC, ⩾0.25 µg/mL but <4 µg/mL) was found in 100 (0.8%) isolates. The 3 most common serotypes among isolates with low-level ciprofloxacin resistance were Salmonella enterica serotype Enteriditis (18 isolates), Salmonella enterica serotype Paratyphi A (18 isolates), and S. Typhimurium (14 isolates). Low-level ciprofloxacin resistance was also found in 2 Salmonella enterica serotype Anatum isolates (2.3%), 7 S. Berta isolates (8.5%), 2 Salmonella enterica serotype Bovismorbificans isolates (8.3%), and 1 S. Mbandaka isolate (1.6%). of the 242 isolates with ciprofloxacin MICs ⩾0.06 µg/mL, 233 (96.3%) were available for screening.

Figure 1
Figure 1

Sequence comparison of qnr alleles. A, qnrB1 and qnrB5. B, qnrS1 and qnrS2. The dots indicate identical amino acid residues.

Figure 2
Figure 2

Regions containing the qnrS gene in the nonconjugative plasmids pMG306 and pMG308. A, In pMG306, ORF1 has 82% amino acid identity with YdaA of Escherichia coli (AAK09055), a putative resolvase. ORF2 and ORF3 each have >80% amino acid identity with both Sea14 (AAR13141) and Sea15 (AAR13142) of Serratia entomophilia and are within inverted repeats represented by arrows. Dashed lines represent unsequenced region. The bold line represents nucleotide sequence identical to pAH0376 of Shigella flexneri (AB187515) and contains qnrS1. B, In pMG308, ORF4 has 74% amino acid identity with RepC of a Pasturella multocida plasmid (YP_232871). ORF5 has 84% amino acid identity with RepA of an Aeromonas salmonicida plasmid (NP_387463). The bold line represents nucleotide sequence with 89% nucleotide identity to pAH0376.

Table 1
Table 1

Ciprofloxacin MICs of non-Typhi serotypes of Salmonella enterica, 1996–2003.

Screening for qnr genes. A PCR product corresponding in size to a positive control could be amplified from 10 (5%) of 233 tested isolates with ciprofloxacin MICs ⩾0.06 µg/mL. No product was detected in the 102 isolates with ciprofloxacin MICs ⩽0.03 µg/mL that were screened. Sequencing confirmed all 10 PCR products to be qnr genes. Four serotypes were involved (table 2). Seven S. Berta isolates, collected from 1997 through 2000, carried qnrB. of the isolates collected in 2002, 1 S. Bovismorbificans isolate carried qnrB, and 1 S. Mbandaka isolate carried qnrS. In 2003, 1 S. Anatum isolate found in a urine sample contained qnrS. All other qnr-positive isolates came from stool samples. All 10 qnr-positive isolates had low-level resistance to ciprofloxacin (MIC, 0.25 µg/mL–0.5 µg/mL). Eight of the 10 isolates were resistant to nalidixic acid, and 9 of the 10 were resistant to non-quinolone antimicrobials. The qnr gene was not found in any of the fully ciprofloxacin-resistant isolates in the collection.

Table 2
Table 2

Characteristics of Salmonella isolates with positive test results for the qnr gene.

Transfer of quinolone resistance. Quinolone resistance was transferred to E. coli J53 AziR by conjugation from S. Berta strains 7, 30, and 40 (chosen for their temporal and geographical diversity) and S. Mbandaka strain 60 and by transformation from S. Bovismorbificans strain 56 and S. Anatum strain 77. The 3 S. Berta strains transferred qnrB-bearing plasmids identical in size and resistance properties that are represented by pMG305, a 95-kb plasmid that carries resistance to ampicillin and gentamicin, as well as to quinolones. The qnrB-bearing plasmid from the S. Mbandaka isolate (pMG307) carried resistance to ampicillin and sulfamethoxazole. It was found to harbor the extended-spectrum β-lactamase SHV-30. The nonconjugative qnrS plasmids in S. Bovismorbificans (pMG306) and S. Anatum (pMG308) were 10 kb and 8 kb in size, respectively, and neither appeared to carry other resistance genes (table 3).

Table 3
Table 3

Profiles of transconjugants and/or transformants and quinolone resistance recipient Escherichia coli J53.

Sequencing of qnr genes and flanking DNA. The qnrB allele from S. Mbandaka was identical to a variant (qnrB2) that is predominant among recent isolates of Klebsiella and Enterobacter species collected in the United States [8]. The qnrB allele found on pMG305 from S. Berta was novel, comprising a 678-bp open reading frame encoding a protein (QnrB5) with 95.6% amino acid identity to QnrB1 (figure 1). The qnrS allele (now designated qnrS1) located on pMG306 from S. Bovismorbificans showed complete sequence identity to that previously found on conjugative plasmid pAH0376 from a Shigella species strain isolated in Japan [9]. Sequencing of pMG306 from S. Bovismorbificans showed that qnrS1 was located within a 1087-bp segment identical to the region including and surrounding qnrS1 in pAH0376 (figure 2). This region was flanked by inverted repeat segments at least 1.2 kb in length that are related to a putative insertion sequence in a plasmid from a Serratia species isolate. (GenBank accession number AF135182). The qnrS allele detected on pMG308 from S. Anatum codes for a protein 91.3% identical in amino acid sequence to QnrS1 and has been designated qnrS2 (figure 1). pMG308 had no similarity to pAH0376 in ∼5 kb of flanking sequence, nor did this region appear to include resistance genes, transposable elements, or components of an integron. Open reading frames similar to repC and repA, genes involved in plasmid replication, were located immediately downstream of qnrS2. A third open reading frame, 606 bp in length, had no related sequence in GenBank.

QRDR sequencing. No gyrA mutations were detected in the qnr-positive Salmonella isolates. Strains 56 and 60, the S. Bovismorbificans and the S. Mbandaka isolates, had wild-type sequence for gyrB codons 443 and 444. The other isolates had gyrB point mutations with the resulting amino acid substitutions Ala443Val and Arg444Lys. In parC, the following substitutions were found: Thr57Ser alone (4 substitutions); Met49Ile, Ser50Ala, and Thr57Ser (3 substitutions); Met49Ile and Thr57Ser (2 substitutions); and Met49Ile and Ser50Ala (1 substitution). None of these gyrB and parC mutations have been linked to quinolone resistance.

Previous SectionNext Section

Discussion

This is the first report of plasmid-mediated quinolone resistance in Salmonella isolates from the United States. Ten of 335 tested isolates were positive for either qnrB or qnrS. The Salmonella plasmids bearing a qnr gene were neither an isolated nor a local phenomenon. We identified qnr genes in 4 non-Typhi serotypes: S. Anatum, S. Berta, S. Bovismorbificans, and S. Mbandaka. The geographical distribution of these strains was broad, with 3 strains collected from the east coast of the United States, 6 from the west coast, and 1 from Hawaii.

Seven of the 10 qnr-positive isolates in this study were S. Berta, a poultry-associated serotype. Although 6 of the S. Berta isolates were found in specimens from residents of Los Angeles County, California, they were not associated with any known outbreak, and each isolate had a unique PFGE pattern (data not shown). In Hong Kong, plasmids containing a variant of qnrA were recently described in S. Enteritidis, another poultry-associated serotype [11].

Plasmid-mediated quinolone resistance in Salmonella has important public health implications. Fluoroquinolones, such as ciprofloxacin, are commonly used to treat adults with invasive illness or other serious infections due to Salmonella species. A number of studies indicate that patients infected with Salmonella with low-level fluoroquinolone resistance may respond poorly to fluoroquinolone treatment [18]. Low- and high-level flouroquinolone resistance has become increasingly prevalent, especially in Asia [19, 20], but also in Europe and North America (J. Stevenson, F. Angulo, K.G., T.B., F.M., T.C.; unpublished data) [21]. The emergence and spread of qnr genes on plasmids would further promote the rapid spread of fluoroquinolone resistance. Furthermore, plasmid-mediated quinolone resistance appears often to be cotransmitted with resistance to broad-spectrum β-lactams, enabling the promulgation of simultaneous resistance to 2 classes of antimicrobial agents commonly used to treat serious Salmonella infection and coselection by use of either agent alone.

To determine whether qnr genes alone were the likely determinants of reduced ciprofloxacin susceptibility, we sequenced the QRDRs of gyrA, gyrB, parC, and parE in all 10 isolates. All isolates had wild-type gyrA. Point mutations were detected in gyrB, parC, and parE, but the significance of these mutations is unclear, because they have not been linked to reduced susceptibility to quinolones. All qnr-positive isolates, except for S. Bovismorbificans, had a parC Tyr57Ser substitution. This substitution was previously described in Salmonella species by Eaves et al. [16] as being associated with increased susceptibility to ciprofloxacin but not nalidixic acid. The elevated quinolone MICs of the E. coli transconjugants suggest that reduced ciprofloxacin susceptibility of these Salmonella isolates is attributable to the plasmid-encoded genes alone. The Clinical and Laboratory Standards Institute recommends that extraintestinal Salmonella isolates be screened for nalidixic acid resistance (MIC, ⩾32 µg/mL) [15]. Our findings suggest that salmonellae in which the single mechanism of resistance is not a QRDR mutation, but a qnr gene, may have a nalidixic acid MIC as low as 16 µg/mL and, hence, would be missed by the recommended clinical laboratory screening.

The ongoing sources of selective pressure driving quinolone resistance are not certain. In 1996, the veterinary fluoroquinolone, enrofloxacin, was approved by the Food and Drug Administration for the control of chicken mortality associated with E. coli and turkey mortality associated with E. coli and Pasteurella multocida. The subsequent emergence of fluoroquinolone-resistant Campylobacter species and the associated public health hazard led to the recent withdrawal of enrofloxacin for use in poultry in July 2005 [22]. Although this action should reduce selective pressure for the dissemination of quinolone resistance of Salmonella in poultry, fluoroquinolones continue to be used in the treatment of beef cattle in the United States. Also, imported foods and foreign travel remain threats to human health from quinolone use in food animals in other countries.

We have demonstrated that plasmid-mediated quinolone resistance exists among non-Typhi Salmonella isolates in the United States. The presence of multiple variants of qnr genes suggests they have a substantial evolutionary history, and their presence in several Salmonella serotypes, from widely separated states, suggests broad host and geographic distribution. The relatively low MIC of nalidixic acid found in these organisms raises the concern that these genes could spread insidiously, resulting in a substantial population of organisms on the threshold of high-level resistance that would continue to be exposed to quinolones. We identified qnr genes on 4 substantially different plasmids. The cotransmission of extended-spectrum β-lactamases on such plasmids is a particular threat to therapy. Characterization of Salmonella strains from animals and foods may clarify the sources and selective pressures leading to the emergence of these strains. Conjugative qnr-bearing plasmids in non-Typhi Salmonella demonstrate the sobering potential for quinolone resistance selected and maintained through antibiotic use in animals to take hold in human flora.

Previous SectionNext Section

Acknowledgments

We thank the epidemiologists and microbiologists of state and local public health departments for their contributions to NARMS.

Financial support. Interagency agreement between the Food and Drug Administration and the Centers for Disease Control and Prevention (K.G., T.J.M., F.M. and T.M.C.); National Institutes of Health, US Public Health Service grants AI43312 (to G.A.J.) and AI57576 (to D.C.H.).

Potential conflicts of interest. All authors: no conflicts.

  • Received January 21, 2006.
  • Revision received April 17, 2006.
Previous Section
 

References

  1. ↵
    1. Jacoby GA
    . Mechanisms of resistance to quinolones. Clin Infect Dis 2005;41(Suppl 2):120-6.
    CrossRef
  2. ↵
    1. Martinez-Martinez L,
    2. Pascual A,
    3. Jacoby GA
    . Quinolone resistance from a transferable plasmid. Lancet 1998;351:797-9.
    CrossRefMedlineWeb of Science
  3. ↵
    1. Wang M,
    2. Tran JH,
    3. Jacoby GA,
    4. Zhang Y,
    5. Wang F,
    6. Hooper DC
    . Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob Agents Chemother 2003;47:2242-8.
    Abstract/FREE Full Text
  4. ↵
    1. Tran JH,
    2. Jacoby GA
    . Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci U S A 2002;99:5638-42.
    Abstract/FREE Full Text
  5. ↵
    1. Nordmann P,
    2. Poirel L
    . Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J Antimicrob Chemother 2005;56:463-9.
    Abstract/FREE Full Text
  6. ↵
    1. Wang M,
    2. Sahm DF,
    3. Jacoby GA,
    4. Hooper DC
    . Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob Agents Chemother 2004;48:1295-9.
    Abstract/FREE Full Text
  7. ↵
    1. Robicsek A,
    2. Sahm DF,
    3. Strahilevitz J,
    4. Jacoby GA,
    5. Hooper DC
    . Broader distribution of plasmid-mediated quinolone resistance in the United States. Antimicrob Agents Chemother 2005;49:3001-3.
    Abstract/FREE Full Text
  8. ↵
    1. Jacoby GA,
    2. Walsh KE,
    3. Mills DM,
    4. et al
    . qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob Agents Chemother 2006;50:1178-82.
    Abstract/FREE Full Text
  9. ↵
    1. Hata M,
    2. Suzuki M,
    3. Matsumoto M,
    4. et al
    . Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob Agents Chemother 2005;49:801-3.
    Abstract/FREE Full Text
  10. ↵
    1. Angulo FJ,
    2. Johnson KR,
    3. Tauxe RV,
    4. Cohen ML
    . Origins and consequences of antimicrobial-resistant nontyphoidal Salmonella: implications for the use of fluoroquinolones in food animals. Microb Drug Resist 2000;6:77-83.
    MedlineWeb of Science
  11. ↵
    1. Cheung TK,
    2. Chu YW,
    3. Chu MY,
    4. Ma CH,
    5. Yung RW,
    6. Kam KM
    . Plasmid-mediated resistance to ciprofloxacin and cefotaxime in clinical isolates of Salmonella enterica serotype Enteritidis in Hong Kong. J Antimicrob Chemother 2005;56:586-9.
    Abstract/FREE Full Text
  12. ↵
    1. Voetsch AC,
    2. Van Gilder TJ,
    3. Angulo FJ,
    4. et al
    . FoodNet estimate of the burden of illness caused by nontyphoidal Salmonella infections in the United States. Clin Infect Dis 2004;38(Suppl 3):127-34.
    CrossRef
  13. ↵
    1. Ruiz M,
    2. Rodriguez JC,
    3. Escribano I,
    4. Royo G
    . Available options in the management of non-Typhi Salmonella. Expert Opin Pharmacother 2004;5:1737-43.
    CrossRefMedlineWeb of Science
  14. ↵
    1. National Antimicrobial Resistance Monitoring Service (NARMS)
    . Enteric bacteria. Available at: http://www.cdc.gov/narms/. Accessed 15 June 2006.
  15. ↵
    1. Clinical and Laboratory Standards Institute (CLSI)
    . Performance standards for antimicrobial susceptibility testing: fifteenth informational supplement (M100-S15). Wayne, PA: CLSI; 2005.
  16. ↵
    1. Eaves DJ,
    2. Randall L,
    3. Gray DT,
    4. et al
    . Prevalence of mutations within the quinolone resistance-determining region of gyrA, gyrB, parC, and parE and association with antibiotic resistance in quinolone-resistant Salmonella enterica. Antimicrob Agents Chemother 2004;48:4012-5.
    Abstract/FREE Full Text
  17. ↵
    1. Bioedit: biological sequence aligment editor for Win 95/98/NT/2K/XP
    . Available at: http://www.mbio.ncsu.edu/BioEdit/bioedit.html. Accessed 15 June 2006.
  18. ↵
    1. Crump JA,
    2. Barrett TJ,
    3. Nelson JT,
    4. Angulo FJ
    . Reevaluating fluoroquinolone breakpoints for Salmonella enterica serotype Typhi and for non-Typhi salmonellae. Clin Infect Dis 2003;37:75-81.
    Abstract/FREE Full Text
  19. ↵
    1. Turnidge J
    . Epidemiology of quinolone resistance. Eastern hemisphere. Drugs 1995;49(Suppl 2):43-7.
    CrossRefMedline
  20. ↵
    1. Hoge CW,
    2. Gambel JM,
    3. Srijan A,
    4. Pitarangsi C,
    5. Echeverria P
    . Trends in antibiotic resistance among diarrheal pathogens isolated in Thailand over 15 years. Clin Infect Dis 1998;26:341-5.
    Abstract/FREE Full Text
  21. ↵
    1. Hakanen A,
    2. Kotilainen P,
    3. Huovinen P,
    4. Helenius H,
    5. Siitonen A
    . Reduced fluoroquinolone susceptibility in Salmonella enterica serotypes in travelers returning from Southeast Asia. Emerg Infect Dis 2001;7:996-1003.
    MedlineWeb of Science
  22. ↵
    1. US Food and Drug Administration
    . Enrofloxacin for poultry: withdrawal of approval of Bayer Corporation's new animal drug application (NADA) 140-828 (Baytril). Available at: http://www.fda.gov/cvm/FQWithdrawal.html. Accessed 15 June 2006.
| Table of Contents

This Article

  1. Clin Infect Dis. (2006) 43 (3): 297-304. doi: 10.1086/505397
  1. AbstractFree
  2. » Full Text (HTML)Free
  3. Full Text (PDF)Free

Classifications

Share

  1. Email this article

Navigate This Article

Current Issue

  1. March 1, 2012 54 (5)
  1. Clinical Infectious Diseases
  1. Alert me to new issues

Most