Skip Navigation

Conjunctival Chlamydial 16S Ribosomal RNA Expression in Trachoma: Is Chlamydial Metabolic Activity Required for Disease to Develop?

  1. Matthew J. Burton1,2,
  2. Martin J. Holland1,2,
  3. David Jeffries2,
  4. David C. W. Mabey1, and
  5. Robin L. Bailey1,2
  1. 1London School of Hygiene and Tropical Medicine, London, United Kingdom
  2. 2Medical Research Council Laboratories, Fajara, The Gambia
  1. Reprints or correspondence: Dr. Matthew Burton, International Centre for Eye Health, Dept. of Tropical and Infectious Diseases, London School of Hygiene and Tropical Medicine, Keppel St., London WC1E 7HT, United Kingdom (matthew.burton{at}lshtm.ac.uk).
 
Next Section

Abstract

Background. Nucleic acid amplification testing frequently detects conjunctival Chlamydia trachomatis infection in subjects without clinical signs of trachoma. It is unclear whether such subjects are actually infected. We measured chlamydial 16S ribosomal RNA (rRNA) expression, a marker of chlamydial metabolic activity, in comparison with the quantitation of a chlamydial DNA target in subjects exposed to trachoma.

Methods. Subjects from 2 Gambian villages where trachoma was endemic were examined. Conjunctival samples were tested for the presence of C. trachomatis DNA using a quantitative real-time polymerase chain reaction (PCR) assay for the omp1 gene and for the expression of C. trachomatis 16S rRNA using a 1-step, real-time reverse-transcriptase PCR assay.

Results. A total of 248 people were examined. The prevalence of clinically active trachoma was 16.9%. C. trachomatis was detected in 19.8% and 6.8% of subjects by the omp1 and 16S rRNA assays, respectively. For subjects with positive results for both tests, the number of copies of 16S rRNA was ∼100-fold greater than the number of copies of the omp1 gene. In samples from subjects in whom the omp1 gene was detected in the absence of 16S rRNA, typically only a few copies of omp1 were present. The expression of 16S rRNA was strongly associated with the presence of clinical signs of active trachoma.

Conclusions. The use of 16S rRNA expression for the detection of chlamydial metabolic activity appears to usefully discriminate established infections from the inoculation of the conjunctiva with dead or subviable organisms, which probably occurs frequently in settings in which trachoma is endemic. The data support conclusions from primate challenge studies that live Chlamydiae species or antigens derived from them are needed to provoke the clinical signs of disease.

Trachoma is the leading infectious cause of blindness [1]. Recurrent Chlamydia trachomatis infection produces chronic follicular conjunctivitis (clinically active trachoma), which produces conjunctival scarring, entropion, trichiasis, and ultimately blinding corneal opacification. Trachoma is a major public health problem, affecting some of the world's poorest regions. In a global effort to control blinding trachoma, the World Health Organization (WHO) and partners promote the SAFE strategy [2], which involves provision of surgery for trichiasis, distribution of antibiotics to reduce the burden of chlamydial infection, and face washing and environmental changes to limit transmission.

Identification and treatment of individuals infected with C. trachomatis is necessary for the success of the antibiotic component of this strategy. However, clinical signs of trachoma are unreliable markers of infection. Sensitive PCR assays regularly detect C. trachomatis DNA in clinically healthy people in areas of endemicity [3–5]. Whether these individuals harbor infection of epidemiological significance is unknown. Studies using quantitative real-time PCR assays for detection of omp1 (a single-copy gene on the C. trachomatis chromosome) to estimate conjunctival chlamydial infection load in members of communities in which infection is endemic found highly skewed distributions; most individuals had relatively low numbers of copies of omp1, whereas a few individuals had many hundreds of thousands of copies of omp1 [6–8]. The detection of low-level omp1 DNA in these studies might reflect the high sensitivity of DNA amplification assays for subjects with transient inoculations or environmental or physical contamination, rather than established infection. It is unclear how far detection of ocular chlamydial DNA reflects productive infection at the conjunctival surface.

Chlamydiae species exist in 2 principal forms in the developmental cycle established in tissue culture systems [9]. The elementary body is the metabolically inactive, infectious, extracellular form in which genomic DNA is condensed and transcription is limited or absent. On infection of the host cell, the elementary body transforms into the reticulate body form, becoming metabolically active and dividing by binary fission. Chlamydial 16S rRNA is one of the most prominent genes expressed when elementary bodies transform into actively replicating reticulate bodies, and its high-level expression may, therefore, be a marker for actively replicating or viable organisms [10–12]. As a component of the chlamydial ribosome, it is vital for normal functioning of the organism. Besides being a marker for in vitro metabolic activity, 16S rRNA expression is proportionate to the number chlamydial organisms present [12].

To better elucidate the relationship between established conjunctival chlamydial infection and DNA detection, we studied expression of chlamydial 16S rRNA in conjunctival samples from a community in which trachoma was endemic in relation to quantitative detection of omp1 DNA, clinical features, and parameters associated with trachoma transmission.

Previous SectionNext Section

Methods

Ethical permission. This study was conducted in accordance with the Declaration of Helsinki. It was approved by the Gambian Government/Medical Research Council Joint Ethics Committee. Informed consent was a prerequisite.

Community survey. The study was conducted in 2 Gambian villages. Following household survey and census, all individuals normally resident in the villages were enrolled. Each individual's age, sex, ethnic group, and sleeping room were recorded. Environmental and socioeconomic indicators were recorded.

Clinical assessment. An ophthalmologist graded the left eye of each subject for trachoma, using the WHO Trachoma Grading System [13]. Clinically active trachoma was defined as either a follicular score of 2 or 3 or a papillary score of 3, equivalent to “trachomatous inflammation, follicular” and “trachomatous inflammation, intense,” respectively, according to the WHO Simplified Trachoma Grading System [14]. The conjunctiva was anaesthetised with proxymetacaine 0.5% eye drops (Minims; Chauvin Pharmaceuticals). Two swab samples were collected from the left tarsal conjunctival surface (Dacron polyester-tipped swab; Hardwood). Sampling was standardized as 4 horizontal passes across the conjunctiva, with a one-quarter turn between each pass. The first sample, which was used for RNA isolation, was stabilized in 0.2 mL of RNALater (Ambion). The second sample, which was used for DNA isolation, was collected into a dry tube. Samples were kept on ice until transfer to -20°C storage later the same day.

RNA extraction. Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer's instructions. In brief, samples were vortexed in 350 µL of RLT buffer, cellular material was homogenized by centrifugation through a QIAshredder, mixed with 350 µL of 70% ethanol, and centrifuged through an RNeasy spin column. The column was washed twice with 350 µL of RW1 and twice with 500 µL of RPE, was dried by centrifugation, and RNA was eluted with 50 µL of RNase-free water. Extracted RNA was stored at -80°C. Total RNA was measured using RiboGreen RNA quantitation kit (Molecular Probes) according to the manufacturer's instructions. Microplates were read on a SpectraMax plate reader (Molecular Devices).

Quantitation of C. trachomatis 16S rRNA. C. trachomatis 16S rRNA expression was quantitated in duplicate by real-time RT-PCR using QuantiTect SYBR Green RT-PCR kit (Qiagen). Each reaction contained 12.5 µL of QuantiTect SYBR Green RT-PCR Master Mix, 1 µL (final concentration, 0.5 µmol/L) each of forward (GGAGAAAAGGGAATTTCACG) and reverse (TCCACATCAAGTATGCATCG) primers, 8.25 µL of water, 0.25 µL of QuantiTect RT Mix, and 2 µL of extracted RNA sample. Samples were tested in duplicate on an ABI 5700 (Applied Biosystems). RNA was reverse transcribed by incubation at 50°C for 30 min, followed by heating at 95°C for 15 min to activate HotStarTaq DNA Polymerase, 45 cycles of denaturation at 94°C for 15 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, and finally data acquisition after 75°C for 15 s. Melting-point analysis was performed on the product.

A standard calibration curve was generated with each run by quantitation of a series of 10-fold dilutions of C. trachomatis 16S rRNA cDNA target, from 106 to 10 copies/µL. A concentrated solution of target DNA was first produced by PCR amplification of 16S rRNA cDNA, and the concentration was determined using a PicoGreen assay (Molecular Probes). The number of copies of the 173-bp 16S rRNA cDNA product was estimated using the concentration, Avogadro's number, and the molecular mass of a single base pair in daltons. Serial dilutions of the 16S rRNA product were made in ultra-pure autoclaved water containing 2 ng/µL herring sperm DNA (Sigma) and stored at -20°C.

Quantitation of C. trachomatis omp1 DNA. DNA was extracted from the second swab sample using the Amplicor CT/NG kit (Roche) by a previously described methodology [6]. An aliquot of Amplicor DNA extract for each sample was further purified and concentrated using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer's instructions. The C. trachomatis omp1 copy number in the purified extract was estimated by real-time PCR performed on an ABI 5700 Sequence Detection System [6].

Data analysis. Estimated quantities of omp1 and 16S rRNA are expressed as number of copies per swab. Data were analyzed using Stata software, version 7 (Stata). A multivariable logistic regression model for infection was developed that used generalized estimating equations to take into account clustering of infection at compound level [6].

Previous SectionNext Section

Results

Study population. Two hundred forty-eight people from 2 villages in which trachoma was endemic participated in the study (79% of the total population of the 2 villages). Most (91%) of those not participating in the study had travelled. Subjects were of Wolof ethnicity. Median age was 12 years (interquartile range, 4–25 years), and 59.3% of the subjects were female. Forty-two individuals had clinically active trachoma. All families had access to water within a few minutes walk of their compound throughout the year. One family had a latrine.

Comparison of the assays for C. trachomatis detection. C. trachomatis nucleic acid was detected in 49 (19.8%) and 17 (6.8%) of the samples by omp1 quantitative PCR and 16S rRNA quantitative RT-PCR, respectively. Expression of 16S rRNA was detected in 16 (32%) of 49 samples containing detectable chlamydial omp1 DNA and in 1 (0.5%) of 199 samples without detectable chlamydial omp1 DNA (table 1).

Figure 1
Figure 1

Chlamydia trachomatis infection load, as determined by quantitative PCR for omp1, by whether 16S rRNA was also detected

Figure 2
Figure 2

Chlamydia trachomatis infection load, as determined by quantitative PCR for omp1, by age. *, 2 subjects; ×, 4 subjects.

Figure 3
Figure 3

Chlamydia trachomatis infection load, as determined by quantitative PCR for 16S rRNA, by age

Table 1
Table 1

Comparison of omp1 quantitative PCR and 16S rRNA quantitative RT-PCR for detection of conjunctival Chlamydia trachomatis infection.

Infection load distributions. Distributions of estimated number of copies of omp1 DNA and 16S rRNA are shown in table 2. The distribution of the number of copies of omp1 was skewed; many individuals had very low levels. For subjects for whom both assays had positive results, the estimated number of copies was positively correlated (r = 0.61), and the estimated number of copies of 16S rRNA was ∼2 orders of magnitude greater than the estimated number of omp1 copies (data not shown). The 33 subjects for whom omp1 DNA but not 16S rRNA was detected had significantly fewer copies of omp1 (geometric mean number of copies, 9.53; 95% CI, 7.7–11.7) than did the 16 subjects for whom both 16S rRNA and omp1 DNA were detected (geometric mean number of copies, 4118; 95% CI, 954–17,782) (figure 1).

Table 2
Table 2

Distribution of patients by omp1 DNA quantitative PCR and 16S rRNA quantitative RT-PCR results.

Infection and clinically active disease. The relationship between clinically active trachoma and detection of C. trachomatis omp1 DNA and 16S rRNA is presented in table 3. Less than one-half of those subjects with active trachoma had detectable levels of omp1 DNA or 16S rRNA. Active trachoma was present in 14 (82%) of 17 subjects with detectable 16S rRNA, compared with 28 (12%) of 231 subjects without detectable 16S rRNA (relative risk, 6.79; 95% CI, 4.5–10.25; P < .00001). In contrast, only 18 (37%) of 49 subjects with detectable levels of omp1 DNA had clinically active trachoma, compared with 24 (12%) of 199 subjects without detectable levels of omp1 DNA (relative risk, 3.05; 95% CI, 1.8–5.15; P < .0001). Thus, clinical signs of trachoma were more strongly associated with 16S rRNA expression than with detection of chlamydial omp1 DNA.

Table 3
Table 3

Association of omp1 DNA detection and 16S rRNA detection with active trachoma.

Load of infection and clinical disease. For both assays, load of infection was higher among those subjects with signs of active trachoma (table 4). Increasing severity of conjunctival inflammation and follicle scores was associated with increasing 16S rRNA load. There was a less marked trend for omp1 load (table 4).

Table 4
Table 4

Number of copies of chlamydial omp1 DNA and 16S rRNA, by clinical grade.

Load of infection and age. Infection—particularly infection associated with a high number of omp1 and 16S rRNA copies—was concentrated in children.There were several adults with generally low omp1 loads, whereas chlamydial 16S rRNA was detected only in children, with the exception of a single 27-year-old woman with active trachoma (figures 2 and 3).

Risk factors for infection. Univariate associations between risk factors and detection of chlamydial nucleic acid are presented in table 5. In this analysis, individuals in whom either 16S rRNA or omp1 DNA were detected are compared with individuals who had negative results according to the same test. In addition, individuals who had results positive for omp1 and negative for 16S rRNA were separately compared with individuals who had negative results for both tests. Expression of 16S rRNA was strongly associated with clinically active disease and with the presence of another individual with active disease in the same room. Detection of omp1 DNA was less strongly associated with active disease. In individuals with test results positive for omp1 and negative for 16S rRNA, the presence of omp1 DNA was not associated with active disease.

Table 5
Table 5

Univariate analysis of factors predicting the presence of omp1 DNA and 16S rRNA.

A multivariable logistic regression model for 16S rRNA expression, adjusted for compound level clustering of infection by generalized estimating equations, was developed (table 6). Clinically active disease and the presence of another individual with active disease in the same room were associated with detection of 16S rRNA.

Table 6
Table 6

Multivariable logistic regression model for subjects with detectable 16S rRNA, compared with uninfected individuals.

Measurement of total RNA. Most samples had a good yield of RNA, with a median concentration 12.5 ng/µL (interquartile range, 8.1–19.1 ng/µL; total range, 1.0–81.8 ng/µL). There was no significant evidence that estimates of chlamydial 16S rRNA expression were dependent on total RNA yield (data not shown). Marginally greater amounts of total RNA were realized from individuals with inflamed conjunctivae, but this was not statistically significant (data not shown).

Previous SectionNext Section

Discussion

This study demonstrated expression of C. trachomatis 16S rRNA in conjunctival samples obtained from members of a Gambian community in which trachoma was endemic with use of quantitative RT-PCR. 16S rRNA was detected in less than one-half of subjects with detectable levels of C. trachomatis omp1, and it was much more strongly associated with active disease than was omp1. Detection of 16S rRNA was associated with higher omp1 levels. In contrast, detection of chlamydial DNA in the absence of 16S rRNA was associated with low loads of omp1 and normal clinical examination findings.

In situ hybridization studies of C. trachomatis 16S rRNA expression in conjunctival samples obtained from primate models and of natural disease in humans suggested that C. trachomatis 16S rRNA expression was a good marker of chlamydial infection; 16S rRNA has been shown to be detectable even when the results of direct immunofluorescence tests are negative [15, 16]. Expression of 16S rRNA is necessary for the transformation of chlamydial elementary bodies to reticulate bodies. Without ribosomes, new proteins cannot be synthesized. In vitro studies using real-time PCR have demonstrated a rapid increase in 16S rRNA expression during the first 8 h after C. trachomatis infection in cell culture [12]. The amount of 16S rRNA expressed in reticulate bodies was ∼2 orders of magnitude greater than the number of gene copies in the same samples. There are conflicting data as to whether 16S rRNA is normally detectable in elementary bodies. Some studies have not found 16S rRNA in elementary bodies, whereas other studies have found up to 103 molecules of 16S rRNA [10, 11]. However, expression is greatly increased in the replicating reticulate body stage, in which it reflects the total number of organisms present [12]. Thus, 16S rRNA expression in tissue culture marks the phase of metabolic activity and active replication in the chlamydial developmental cycle. Our data suggest that, in subjects exposed to ocular C. trachomatis infection, detection of chlamydial metabolic activity is strongly associated with clinical signs of active disease and is consistent with the presumption that established productive infection is a prerequisite for signs of disease to develop.

Consistent with this, studies of a primate model of trachoma found that signs of disease could not be provoked in previously sensitized animals by repeated conjunctival challenge with formalin- or UV-inactivated elementary body preparations or with specific purified surface antigens [17]. However, an inflammatory response was elicited by a soluble extract derived from replicating organisms that was subsequently found to contain a chlamydial heat shock protein now designated Hsp60 or groEL [17–19]. This suggests that the inflammatory response underlying the clinical signs of trachoma is not attributable to repeated exposure to chlamydial surface antigens (or dead organisms), but that an established infection (or an antigenic product derived from living organisms) is required to initiate it.

It has been suggested that 16S rRNA is an indicator of viability; a study found that 16S rRNA became rapidly undetectable after treatment of C. trachomatis cervical infection, whereas C. trachomatis DNA persisted much longer [20]. Among individuals in whom C. trachomatis DNA but not 16S rRNA was detected, we found that multiplicity of infection was low and that there was no association with clinical disease. This suggests that transient inoculations of the conjunctiva with small numbers of nonviable organisms readily occur in this environment through direct or indirect contact with individuals with productive infection but that this does not usually provoke disease. In this setting, eye-seeking flies have been implicated in trachoma transmission, and individuals may experience hundreds of fly-eye contacts daily [21–23]. These data are consistent with the idea that such mechanical transmission of trachoma via fly-eye contact is an inefficient process, which often results in the inoculation of small numbers of dead or subviable organisms but rarely results in the establishment of new disease. Alternatively, detection of low-level chlamydial DNA but not RNA in clinically healthy adults could be due to an effective immune response that suppresses organism replication.

We cannot exclude the possibility that the 16S rRNA assay is less sensitive than the omp1 assay when testing ocular samples. RNA is readily degraded; however, the RNA stabilization and extraction systems used here are well established. Total RNA levels were satisfactory, and there was no evidence that lower yields of total RNA were associated with lower levels of chlamydial 16S rRNA. Samples containing chlamydial 16S rRNA were usually strongly positive, with no samples yielding results close to the limits of detection. Human RNA targets have been readily reverse transcribed and quantitated in all samples in this study [24].

The use of a second swab sample to measure DNA level was necessary for technical reasons and could have introduced systematic bias. However, although it was not possible in this study to evaluate effect of swab sample order on C. trachomatis RNA and DNA estimations, the data suggest that it is possible to measure significant omp1 loads in the second swab sample. omp1 DNA that is measured in this way gives data consistent with previous studies conducted in this environment, and a study in which additional swab samples were collected found excellent agreement between laboratory test results for the first and second samples [6, 8, 25]. It might also be suggested that low-level omp1 DNA could arise through contamination during sample collection or processing. Careful sample handling at all stages was designed to avoid this. If carry-over contamination occurred at the time of examination from individuals with active infections, we might expect low levels of 16S rRNA to be found in some of the samples, but this was not the case. The detection of low-level omp1 DNA more likely reflects frequent conjunctival “contamination” by low-level transmission of small numbers of organisms.

Current attempts to eliminate blinding trachoma as a public health problem use the SAFE strategy. The WHO recommends community-wide antibiotic treatment if >10% of children aged 1–9 years have active trachoma. At least 3 annual rounds of mass treatment should be given to the entire community. Annual treatment should continue until the prevalence of active trachoma has decreased to <5% in this age group. However, this and other recent studies involving communities in The Gambia and Nepal, where trachoma has a focal distribution, have found that clinical signs of trachoma are a poor predictor of ocular C. trachomatis infection [6, 26]. In some villages that met WHO treatment criteria, not a single person was infected with C. trachomatis. This may be due to nonchlamydial bacterial infection causing conjunctival inflammation. A recent study from Ethiopia, where trachoma is hyperendemic, found that both clinical interobserver reliability and the correlation of clinical examination findings with laboratory evidence of infection were modest [25]. Following mass treatment, clinical signs correlate even less well with infection, compared with before mass treatment is received [8, 27, 28]. Signs may persist for several years after infection has been eliminated from the community. If WHO recommendations were followed, this would lead to administration of systemic or topical antibiotic to large numbers of people who did not require treatment.

An affordable laboratory test for ocular C. trachomatis that could be used in the field would be very useful. However, our study suggests that it may be preferable to base such testing on markers of viable, metabolically active organisms. 16S rRNA may be detected with use of rapid tests based on either nucleic acid sequence—based amplification or transcription-mediated amplification [20, 29]. Alternatively, antigens produced by metabolically active organisms could be targeted. Additional studies may clarify this interpretation, assess response to treatment, and establish whether detecting 16S RNA has utility for targeting treatment or assessing response.

Previous SectionNext Section

Acknowledgments

We thank the residents of the villages participating in this study for their good-humored cooperation and the field team for their hard work.

Financial support. The Medical Research Council (United Kingdom) and the Wellcome Trust/Burroughs Wellcome Fund.

Potential conflict of interest. All authors: no conflicts.

  • Received June 17, 2005.
  • Accepted September 16, 2005.
Previous Section
 

References

  1. ↵
    1. Resnikoff S,
    2. Pascolini D,
    3. Etya'ale D,
    4. et al
    . Global data on visual impairment in the year 2002. Bull World Health Organ 2004;82:844-51.
    MedlineWeb of Science
  2. ↵
    1. World Health Organization
    . Global elimination of blinding trachoma [resolution WHA 51.11 adopted by the World Health Assembly, 16 May 1998]. Available at: http://www.who.int/pbd/publications/wha_eb/wha51/en/index.html. Accessed 9 January 2006.
  3. ↵
    1. Bobo L,
    2. Munoz B,
    3. Viscidi R,
    4. Quinn T,
    5. Mkocha H,
    6. West S
    . Diagnosis of Chlamydia trachomatis eye infection in Tanzania by polymerase chain reaction/enzyme immunoassay. Lancet 1991;338:847-50.
    CrossRefMedlineWeb of Science
    1. Bailey RL,
    2. Hampton TJ,
    3. Hayes LJ,
    4. Ward ME,
    5. Whittle HC,
    6. Mabey DC
    . Polymerase chain reaction for the detection of ocular chlamydial infection in trachoma-endemic communities. J Infect Dis 1994;170:709-12.
    Abstract/FREE Full Text
  5. ↵
    1. Schachter J,
    2. West SK,
    3. Mabey D,
    4. et al
    . Azithromycin in control of trachoma. Lancet 1999;354:630-5.
    CrossRefMedlineWeb of Science
  6. ↵
    1. Burton MJ,
    2. Holland MJ,
    3. Faal N,
    4. et al
    . Which members of a community need antibiotics to control trachoma? Conjunctival chlamydia trachomatis infection load in Gambian villages. Invest Ophthalmol Vis Sci 2003;44:4215-22.
    Abstract/FREE Full Text
    1. Solomon AW,
    2. Holland MJ,
    3. Burton MJ,
    4. et al
    . Strategies for control of trachoma: observational study with quantitative PCR. Lancet 2003;362:198-204.
    CrossRefMedlineWeb of Science
  8. ↵
    1. Burton MJ,
    2. Holland MJ,
    3. Makalo P,
    4. et al
    . Re-emergence of Chlamydia trachomatis infection after mass antibiotic treatment of a trachoma-endemic Gambian community: a longitudinal study. Lancet 2005;365:1321-8.
    CrossRefMedlineWeb of Science
  9. ↵
    1. Ward ME
    . The immunobiology and immunopathology of chlamydial infections. APMIS 1995;103:769-96.
    MedlineWeb of Science
  10. ↵
    1. Engel JN,
    2. Ganem D
    . Chlamydial rRNA operons: gene organization and identification of putative tandem promoters. J Bacteriol 1987;169:5678-85.
    Abstract/FREE Full Text
  11. ↵
    1. An Q,
    2. Radcliffe G,
    3. Vassallo R,
    4. et al
    . Infection with a plasmid-free variant chlamydia related to Chlamydia trachomatis identified by using multiple assays for nucleic acid detection. J Clin Microbiol 1992;30:2814-21.
    Abstract/FREE Full Text
  12. ↵
    1. Mathews SA,
    2. Volp KM,
    3. Timms P
    . Development of a quantitative gene expression assay for Chlamydia trachomatis identified temporal expression of sigma factors. FEBS Lett 1999;458:354-8.
    CrossRefMedlineWeb of Science
  13. ↵
    1. Dawson CR,
    2. Jones BR,
    3. Tarizzo ML
    . Guide to trachoma control. Geneva: World Health Organization; 1981.
  14. ↵
    1. Thylefors B,
    2. Dawson CR,
    3. Jones BR,
    4. West SK,
    5. Taylor HR
    . A simple system for the assessment of trachoma and its complications. Bull World Health Organ 1987;65:477-83.
    MedlineWeb of Science
  15. ↵
    1. Cheema MA,
    2. Schumacher HR,
    3. Hudson AP
    . RNA-directed molecular hybridization screening: evidence for inapparent chlamydial infection. Am J Med Sci 1991;302:261-8.
    MedlineWeb of Science
  16. ↵
    1. Hudson AP,
    2. McEntee CM,
    3. Reacher M,
    4. Whittum-Hudson JA,
    5. Taylor HR
    . Inapparent ocular infection by Chlamydia trachomatis in experimental and human trachoma. Curr Eye Res 1992;11:279-83.
    MedlineWeb of Science
  17. ↵
    1. Taylor HR,
    2. Johnson SL,
    3. Schachter J,
    4. Caldwell HD,
    5. Prendergast RA
    . Pathogenesis of trachoma: the stimulus for inflammation. J Immunol 1987;138:3023-27.
    Abstract
    1. Taylor HR,
    2. Maclean IW,
    3. Brunham RC,
    4. Pal S,
    5. Wittum-Hudson J
    . Chlamydial heat shock proteins and trachoma. Infect Immun 1990;58:3061-3.
    Abstract/FREE Full Text
  19. ↵
    1. Morrison RP,
    2. Lyng K,
    3. Caldwell HD
    . Chlamydial disease pathogenesis: ocular hypersensitivity elicited by a genus-specific 57-kD protein. J Exp Med 1989;169:663-75.
    Abstract/FREE Full Text
  20. ↵
    1. Morre SA,
    2. Sillekens PT,
    3. Jacobs MV,
    4. et al
    . Monitoring of Chlamydia trachomatis infections after antibiotic treatment using RNA detection by nucleic acid sequence based amplification. Mol Pathol 1998;51:149-54.
    Abstract
  21. ↵
    1. Emerson PM,
    2. Bailey RL,
    3. Mahdi OS,
    4. Walraven GE,
    5. Lindsay SW
    . Transmission ecology of the fly Musca sorbens, a putative vector of trachoma. Trans R Soc Trop Med Hyg 2000;94:28-32.
    CrossRefMedlineWeb of Science
    1. Emerson PM,
    2. Lindsay SW,
    3. Walraven GE,
    4. et al
    . Effect of fly control on trachoma and diarrhoea. Lancet 1999;353:1401-3.
    CrossRefMedlineWeb of Science
  23. ↵
    1. Emerson PM,
    2. Lindsay SW,
    3. Alexander N,
    4. et al
    . Role of flies and provision of latrines in trachoma control: cluster-randomised controlled trial. Lancet 2004;363:1093-8.
    CrossRefMedlineWeb of Science
  24. ↵
    1. Burton MJ,
    2. Bailey RL,
    3. Jeffries D,
    4. Mabey DC,
    5. Holland MJ
    . Cytokine and fibrogenic gene expression in the conjunctivas of subjects from a Gambian community where trachoma is endemic. Infect Immun 2004;72:7352-6.
    Abstract/FREE Full Text
  25. ↵
    1. Miller K,
    2. Schmidt G,
    3. Melese M,
    4. et al
    . How reliable is the clinical exam in detecting ocular chlamydial infection? Ophthalmic Epidemiol 2004;11:255-62.
    CrossRefMedlineWeb of Science
  26. ↵
    1. Baral K,
    2. Osaki S,
    3. Shreshta B,
    4. et al
    . Reliability of clinical diagnosis in identifying infectious trachoma in a low-prevalence area of Nepal. Bull World Health Organ 1999;77:461-6.
    MedlineWeb of Science
  27. ↵
    1. Solomon AW,
    2. Holland MJ,
    3. Alexander ND,
    4. et al
    . Mass treatment with single-dose azithromycin for trachoma. N Engl J Med 2004;351:1962-71.
    CrossRefMedlineWeb of Science
  28. ↵
    1. Bird M,
    2. Dawson CR,
    3. Schachter JS,
    4. et al
    . Does the diagnosis of trachoma adequately identify ocular chlamydial infection in trachoma-endemic areas? J Infect Dis 2003;187:1669-73.
    Abstract/FREE Full Text
  29. ↵
    1. Morre SA,
    2. Sillekens P,
    3. Jacobs MV,
    4. et al
    . RNA amplification by nucleic acid sequence-based amplification with an internal standard enables reliable detection of Chlamydia trachomatis in cervical scrapings and urine samples. J Clin Microbiol 1996;34:3108-14.
    Abstract/FREE Full Text
| Table of Contents

This Article

  1. Clin Infect Dis. (2006) 42 (4): 463-470. doi: 10.1086/499814
  1. AbstractFree
  2. » Full Text (HTML)Free
  3. Full Text (PDF)Free

Classifications

Share

  1. Email this article

Navigate This Article

Current Issue

  1. March 1, 2012 54 (5)
  1. Clinical Infectious Diseases
  1. Alert me to new issues

Most